| 293528788 | ...
Draw a Nucleotide | ... | |
| 293528789 | Adenine (A) pairs with what? | T via TWO H-bonds | |
| 293528790 | Thymine (T) pairs with what? | A via TWO H-bonds | |
| 293528791 | Cytosine (C), Pairs with what? | G via THREE H-Bonds | |
| 293528792 | Guanine (G) pairs with what? | C via three H-Bonds | |
| 293528793 | ...
Draw a short DNA helix. Inlcude the bases, sugar backbone, phosphate and exact connectivity (i.e, which element bonds to which, via which type of bond?) | ... | |
| 293528794 | Which of the DNA bases are purines and which are pyrimidines? | Adenine and Guanine are Purines
cytosine (C), thymine (T), and uracil (U) are pyrimidines | |
| 293528795 | What does it mean that DNA replicationi is Bidirectional? | Replication is occurring simultaneously on both strands of the double helix | |
| 293528796 | Semi-conservative | Semiconservative replication would produce two copies that each contained one of the original strands and one new strand.
Conservative replication would leave the two original template DNA strands together in a double helix and would produce a copy composed of two new strands containing all of the new DNA base pairs. | |
| 293528797 | Why is DNA replication Semi-discontinuous? | because DNA replicates from the 3' end to the 5' end (looking at the original piece) so one side will be able replicate continuously (the leading strand) and the other side will start at the replication fork and work backwards and then start at the fork again to fill in the gaps | |
| 293528798 | Tell the story of DNA replication from beginning to end: (include primer [not promoter], lagging/leading strand, Okazaki fragments, helicase, DNA polymerase, and DNA ligase) | Helicase separates the DNA helix
RNA primase lays down a RNA primer
One strand is copied continuously (the leading strand)
The other strand must work backwards (Lagging strand) make installments called Okazaki Fragments
DNA polymerase I replaces the RNA primer with DNA
DNA ligase connects the Okazaki fragments | |
| 293528799 | What are Telomeres | A telomere is a region of repetitive DNA sequences at the end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes | |
| 293528800 | Is a transcription an exact copy? | No it is complementary | |
| 293528801 | What are the differences between DNA and RNA? | RNA has 2' hydroxyl group; DNA doesn't
RNA is usually single-stranded; DNA is double
RNA contains uracil bases: DNA contains Thymine bases
RNA exists in three forms (mRNA, tRNA and rRNA); DNA exists in only one form
RNA exits the nucleus into the cytoplasm
DNA always stays in the nucleus | |
| 293528802 | Describe the functions of each of the three kinds of RNA. Which one can be considered an enzyme? | mRNA- a molecule of RNA that encodes a chemical "blueprint" for a protein product. mRNA is transcribed from a DNA template, and carries coding information to the sites of protein synthesis: the ribosomes.
tRNA- brings an amino acid to the ribosome that is associated the the correct codon
rRNA- is the RNA component of the ribosome, the enzyme that is the site of protein synthesis in all living cells. Ribosomal RNA provides a mechanism for decoding mRNA into amino acids and interacts with tRNAs during translation | |
| 293528803 | Template Strand, Anti-Coding Strand, Anti-Sense Strand refer to what? | The strand of DNA that is transcribed | |
| 293528804 | Coding Strand and Sense Strand refer to what? | the strand of DNA that is NOT transcribed. | |
| 293528805 | Tell the story of transcription (include RNA polymerase, promoter, pre-mRNA, exons, introns, poly-A tail, and 5' cap) | In order for the transcription to take place, the enzyme that synthesizes RNA, known as RNA polymerase, must attach to the DNA near a gene. Promoters contain specific DNA sequences and response elements that provide a secure initial binding site for RNA polymerase and for proteins called transcription factors that recruit RNA polymerase.
The first (primary) transcript from a protein coding gene is often called a pre-mRNA and contains both introns and exons. Pre-mRNA requires splicing (removal) of introns to produce the final mRNA molecule containing only exons.
Sequences that are joined together in the final mature RNA after RNA splicing are exons
The poly(A) tail is important for the nuclear export, translation, and stability of mRNA. The tail is shortened over time, and, when it is short enough, the mRNA is enzymatically degraded
A 5' cap is put on the other end which plays a role in the ribosomal recognition of messenger RNA during translation into a protein. | |
| 293528806 | The strand of DNA that is NOT transcribed will be an exact match to the pre-mRNA formed with one important exception: | the pre-mRNA has introns that will by cut out | |
| 294653218 | How does the Lac Operon regulate the expression and translation of lactase (the enzyme that digests lactose in bacteria)? | A repressor molecule binds upstream to the controlling region suppression gene expression
Lactose (the Lac Operon inducer molecule binds to the represser molecule and it unbinds from the DNA so RNA polymerase can bind to the DNA and transcipe the protein lactase to digest lactose. | |
| 294653219 | What are the three basic mechanisms for Gene regulation | Rate of transcription: RNA has a short half-life, so gene products will only continue to be expressed if DNA is continually transcribed.
Activators and Repressors: Certain substances upregulate DNA transcription (e.g., lactose in the Lac Operon) while other substance downregulate DNA transcription (e.g., glucose in the Lac Operon)
Permanent or Semi-permanent Repression: methylation or other covalent modification that prevents transcription | |
| 294653220 | What is the start codon? | (the start codon is A-U-G | |
| 294653221 | What are three stop codons? | UAA, UAG and UGA | |
| 294653222 | Do mitochondria use the same genetic code to translate their own DNA? | NO | |
| 294653223 | The human genetic code is said to be both degenerative and unambiguous. What does this mean? | The genetic code is unambiguous. Each codon specifies a particular amino acid, and only one amino acid. In other words, the codon ACG codes for the amino acid threonine, and only threonine.
The genetic code is degenerate. In contrast, each amino acid can be specified by more than one codon. | |
| 294653224 | The following mRNA should produce a protein with how many amino acids?
5' AUAAACAUGCUAAUUCAUUAGUUGAUUAAAAA 3' | 4 | |
| 294653225 | Tell the story of translation (include mRNA, tRNA, rRNA, small subunit, large subunit, initiation, elongation and terminatioin) | Translation begins when the small subunit attaches to the mRNA 5' cap and moves to the initiation site
Initiation begins when tRNA which contains an anti-codon that is complementary to the mRNA codon start codon attaches to the ribosom and the larg subunit binds the small subunit.
Elongation continues as tRNA brings more amino acids that correspond the the following condons
termination occurs when the stop codon is encountered and the ribosome dissociates, releasing the newly formed protein. | |
| 294653226 | Post-Translational modification; | Occurs at the endoplasmic reticulum and the golgi apparatus; often includes addition of polysacharides | |
| 294653227 | Where does translation of mRNA occur? | The ribosomes translate mRNA either by being bound to the outer membrane of the endoplasmic reticulum that surrounds the nucleus or in a free-floating state in the cytoplasm | |
| 294653228 | Somatic cell | A somatic cell is generally taken to mean any cell forming the body of an organism | |
| 294653229 | Point mutation | An alteration in DNA sequence caused by a single nucleotide base change, insertion, or deletion | |
| 294653230 | missense mutation | A form of point mutation resulting in a codon that codes for a different amino acid, and thus, causes the synthesis of a protein with an altered amino acid sequence during translation | |
| 294653231 | neutral mutation | A mutation that has no selective advantage or disadvantage. Considerable controversy surrounds the question of whether such mutations can exist. | |
| 294653232 | silent mutation | A form of point mutation resulting in a codon that codes for the same or a different amino acid but without any functional change in the protein product. | |
| 294653233 | frameshift mutation | A type of gene mutation wherein the addition or deletion of (a number of) nucleotide(s) causes a shift in the reading frame of the codons in the mRNA, thus, may eventually lead to the alteration in the amino acid sequence at protein translation | |
| 294653234 | nonsense mutation | With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the STOP codons | |
| 294653235 | On a the chromosome level
What are Duplications (non-disjuction)? | any duplication of a region of DNA that contains a gene; it may occur as an error in homologous recombination, a retrotransposition event, or duplication of an entire chromosome.
Duplications arise from an event termed unequal crossing-over that occurs during meiosis between misaligned homologous chromosomes. The chance of this happening is a function of the degree of sharing of repetitive elements between two chromosomes. The product of this recombination are a duplication at the site of the exchange and a reciprocal deletion.[ | |
| 294653236 | On a the chromosome level
What are deletions (non-disjuction)? | a part of a chromosome or a sequence of DNA is missing, even entire piece of chromosome.
Deletions can be caused by errors in chromosomal crossover during meiosis. This causes several serious genetic diseases. Deletion also causes frameshift. | |
| 294653237 | On a the chromosome level
What are translocations? | rearrangement of parts between nonhomologous chromosomes. A gene fusion may be created when the translocation joins two otherwise separated genes, the occurrence of which is common in cancer. | |
| 294653238 | On a the chromosome level
What are inversions? | a segment of a chromosome is reversed end to end. An inversion occurs when a single chromosome undergoes breakage and rearrangement within itself | |
| 294653239 | Malignant | the tendency of a medical condition, especially tumors, to become progressively worse and to potentially result in death | |
| 294653240 | Benign | tumor that lacks the ability to metastasize | |
| 294653241 | Metastasis | the spread of a disease from one organ or part to another non-adjacent organ or part | |
| 294653242 | Proto-oncogenes | A proto-oncogene is a normal gene that can become an oncogene due to mutations or increased expression.
Proto-oncogenes code for proteins that help to regulate cell growth and differentiation. Upon activation, a proto-oncogene (or its product) becomes a tumor-inducing agent, an oncogene. | |
| 294653243 | Oncogenes | An oncogene is a gene that has the potential to cause cancer. In tumor cells, they are often mutated or expressed at high levels.
Most normal cells undergo a programmed form of death (apoptosis). Activated oncogenes can cause those cells that ought to die to survive and proliferate instead. Most oncogenes require an additional step, such as mutations in another gene, or environmental factors, such as viral infection, to cause cancer. Since the 1970s, dozens of oncogenes have been identified in human cancer. Many cancer drugs target the proteins encoded by oncogenes | |
| 294653244 | Carcinogens | any substance, radionuclide, or radiation that is an agent directly involved in causing cancer | |
| 295781591 | P1 generation | a generation consisting of stocks which are usually homozygous for one or more traits and from which the parents used in the first cross of a genetic experiment are selected—compare | |
| 295781592 | F1 generation | the first generation produced by a cross and consisting of individuals heterozygous for characters in which the parents differ and are homozygous—called also first filial generation; compare | |
| 295781593 | F2 generation | the generation produced by interbreeding individuals of an F1 generation and consisting of individuals that exhibit the result of recombination and segregation of genes controlling traits for which stocks of the P1 generation differ—called also second filial generation | |
| 295781594 | test-cross | a genetic cross between a homozygous recessive individual and a corresponding suspected heterozygote to determine the genotype of the latter | |
| 295781595 | True-breeding | an organism having certain biological traits which are passed on to all subsequent generations when bred with another true breeding organism for the same traits. In other words, to "breed true" means that two organisms with a particular, inheritable phenotype produce only offspring with that (same) phenotype. | |
| 295781596 | self-pollinate | a form of pollination that can occur when a flower has both stamen and a carpel (pistil) in which the cultivar or species is self fertile | |
| 295781597 | Mendelian ratio | 3:1 ratio between dominant and recessive phenotypes | |
| 295781598 | Phenotype | the observable properties of an organism that are produced by the interaction of the genotype and the environment | |
| 295781599 | Genotype | all or part of the genetic constitution of an individual or group—compare | |
| 295781600 | Heterozygous | having the two genes at corresponding loci on homologous chromosomes different for one or more loci (X,x) | |
| 295781601 | Homozygous | having the two genes at corresponding loci on homologous chromosomes identical for one or more loci (X,X) | |
| 295781602 | gene | specific sequence of nucleotides in DNA or RNA that is located usually on a chromosome and that is the functional unit of inheritance controlling the transmission and expression of one or more traits by specifying the structure of a particular polypeptide and especially a protein or controlling the function of other genetic material | |
| 295781603 | allele | one of two or more forms of a gene or a genetic locus | |
| 295781604 | locus | he specific location of a gene or DNA sequence on a chromosome. | |
| 295781605 | Law of segregation: | Alleles segregate independently of one another when forming gametes | |
| 295781606 | Law of Independent Assortment | Genes located on different chromosomes assort independently | |
| 295781607 | Making predictions for dihybrid crosses | draw out two independent Punnett Squares, one for each trait. To calculate the probability of having two traits in the same individual, multiply the individual probabilities for each trait.
If the number of individuals with a specific genotype of phenotype is asked for, multiply the total probability of having both traits by the total number of individuals in the population | |
| 295781608 | When calculating probabilities, what math do you use if BOTH events must occur simultaneously | Multiply the probabilities of each event | |
| 295781609 | When calculating probabilities, what math do you use if Either events may occur to fulfill the requirement | Add the probabilities of each event | |
| 296182751 | ...
How should you tackle sex-linked inheritance (specifically, x-linked)? | Put a dote on the recessive allele. See example below | |
| 296182752 | Explain why hemophilia is more common in males | emophilia refers to a group of bleeding disorders in which it takes a long time for the blood to clot.
It is an x linked recessive gene so if a female is acarrier, all the male offspring will be infected | |
| 296182753 | What fraction of an affected father's male children will have hemophila? What fraction of his daughters will be carriers? | none of his children will have it but all his daughters will be carriers | |
| 296182754 | incomplete dominance | Incomplete dominance is a form of intermediate inheritance in which one allele for a specific trait is not completely dominant over the other allele. This results in a combined phenotype.
(instead of red or white, you get pink) | |
| 296182755 | co-dominance | It occurs when the contributions of both alleles at a single locus are visible and do not overpower each other in the phenotype. | |
| 296182756 | incomplete penetrance | Instead of pink, you get red and white peddles
a real example is with AB blood. it has both type A and B | |
| 296182757 | limited expressivity | example, the "blue" gene might have an expressivity of 25% for individuals that express the "blue" gene and appear light blue, and 75% for individuals that express the "blue" gene and appear dark blue. Expressivity is measured only when there is 100% penetrance
This differs from penetrance, which refers to the likelihood of the gene generating its associated phenotype at all | |
| 296182758 | polygenic | a phenotypic characteristic (trait) that is attributable to two or more genes | |
| 296182759 | pleiotropy | occurs when one gene influences multiple phenotypic traits. Consequently, a mutation in a pleiotropic gene may have an effect on some or all traits simultaneously. This can become a problem when selection on one trait favors one specific version of the gene (allele), while the selection on the other trait favors another allele. | |
| 296182760 | masaicism | Mosaicism is a condition in which cells within the same person have a different genetic makeup. This condition can affect any type of cell, including:
Blood cells
Egg and sperm cells (gametes)
Skin cells
Mosaicism is caused by an error in cell division very early in the development of the unborn baby.
Example- Mosaic Down Syndrome | |
| 296182761 | genetic imprinting | In diploid organisms, somatic cells possess two copies of the genome. Each autosomal gene is therefore represented by two copies, or alleles, with one copy inherited from each parent at fertilisation. For the vast majority of autosomal genes, expression occurs from both alleles simultaneously. In mammals, however, a small proportion (<1%) of genes are imprinted, meaning that gene expression occurs from only one allele. The expressed allele is dependent upon its parental origin. For example, the gene encoding Insulin-like growth factor 2 (IGF2/Igf2) is only expressed from the allele inherited from the father. | |
| 296182762 | What phenotypic ratio should you see in a dihybrid cross? And what does it mean of there is varience from this expected ratio? | 9:3:3:1
Is this ratio is not seen that indicates possible linkage | |
| 296182763 | What phenotypic ratio should you see in a monohybrid cross? And what does it mean of there is varience from this expected ratio? | 3:1
Is this ratio is not seen that indicates possible linkage | |
| 296182764 | gene pool | the complete set of unique alleles in a species or population. | |
| 296182765 | evolution | any change across successive generations in the heritable characteristics of biological populations | |
| 296182766 | polymorphisms | two or more clearly different phenotypes exist in the same population of a species — in other words, the occurrence of more than one form or morph. In order to be classified as such, morphs must occupy the same habitat at the same time and belong to a panmictic population (one with random mating)
The most common example is sexual dimorphism, which occurs in many organisms and human haemoglobin and blood types. | |
| 296182767 | niche | a term describing the relational position of a species or population in its ecosystem to each other | |
| 296182768 | survival of the fittest | The phrase "survival of the fittest" is not generally used by modern biologists as the term does not accurately convey the meaning of natural selection, the term biologists use and prefer. Natural selection refers to differential reproduction as a function of traits that have a genetic basis. "Survival of the fittest" is inaccurate for two important reasons. First, survival is merely a normal prerequisite to reproduction. Second, fitness has specialized meaning in biology different from how the word is used in popular culture. In population genetics, fitness refers to differential reproduction. "Fitness" does not refer to whether an individual is "physically fit" - bigger, faster or stronger - or "better" in any subjective sense. It refers to a difference in reproductive rate from one generation to the next. | |
| 296182769 | natural selection | the nonrandom process by which biological traits become either more or less common in a population as a function of differential reproduction of their bearers. It is a key mechanism of evolution. | |
| 296182770 | speciation | is the evolutionary process by which new biological species arise. | |
| 296182771 | adaptive radiation | the evolution of ecological and phenotypic diversity within a rapidly multiplying lineage.
Starting with a recent single ancestor, this process results in the speciation and phenotypic adaptation of an array of species exhibiting different morphological and physiological traits with which they can exploit a range of divergent environments | |
| 296182772 | evolutionary bottleneck | an evolutionary event in which a significant percentage of a population or species is killed or otherwise prevented from reproducing.
A slightly different sort of genetic bottleneck can occur if a small group becomes reproductively separated from the main population. This is called a founder effect. | |
| 296182773 | genetic drift | is the change in the frequency of a gene variant (allele) in a population due to random sampling.
Genetic drift may cause gene variants to disappear completely and thereby reduce genetic variation. | |
| 296182774 | carrying capacity | the maximum population size of the species that the environment can sustain indefinitely, given the food, habitat, water and other necessities available in the environment. | |
| 296182775 | R-selection vs K-selection | R-selection= Rabits
K-selection=Kids (as in human children)
R-Selected Species
They are populations that experience rapid growth of the J-curve variety. The offspring produced are numerous, mature quite rapidly, and require very little postnatal care. Consequently, this population grows fast, reproduces quickly, and dies quickly. Bacteria are examples of r- selected species.
K- Selected Species
They are populations of a roughly constant size whose members have low reproductive rates. The offspring produced require extensive postnatal care until they have sufficiently matured. They are very limited in resourses therefore they are a very competitive species. Humans are examples of a k-selected species. | |
| 296182776 | Divergent vs. Convergent Evolution | Convergent evolution describes the acquisition of the same biological trait in unrelated lineages
Divergent evolution is the accumulation of differences between groups which can lead to the formation of new species | |
| 296182777 | A bat and a bird both have wings, Is this an example of convergent of divergent evolution? | Convergent | |
| 296182778 | Hardy-Weinberg Equilibrium: assumptions and formulas | Assumptions:
1-Large population
2-No mutation
3-No immigration or emigration
4-Random mating
5-No natural selection
(Note: these assumptions don't actually exist int he real world. The MCAT may very well ask you to conceptualize hoe H-W predictions will vary from real life)
Fomrulas:
p²+ 2qp +q² = 1
p+q = 1
p=the frequency of (AA)
q=the frequency of (aa)
pq=the frequency of (Aa) | |
| 296364554 | What are the classification levels from kingdom down? | Kingdom→Phylum→Cass→Order→Family→Genus→Species | |
| 296613922 | What is the taxonomic classification of humans | Kingdom - Animalia
Phylum - Chordata
Class - Mammalia
Order - Primates
Family - Hominidae
Genus - Homo
Species - Homo sapiens | |
| 296613923 | What are the general criteria scientists use to decide how to classify organisms? | -Individuals in the same group must be more similar to each other than they are to members of different groups
-Evidence of ancestral state = less argument for separate classification
-Evidence of a degenerative state = more argument for separate classification
-Members of different species should not be able to mate with one another and produce normal, viable, fertile offspring | |
| 296613924 | Symbiosis | is close and often long-term interaction between different biological species
Examples:
Mutualsim
Commensalism
Parasitism | |
| 296613925 | Mutualsim | the way two organisms of different species biologically interact in a relationship in which each individual derives a fitness benefit | |
| 296613926 | Commensalism | a class of relationship between two organisms where one organism benefits but the other is neutral (there is no harm or benefit) | |
| 296613927 | Parasitism | a type of non mutual relationship between organisms of different species where one organism, the parasite, benefits at the expense of the other, the host | |
| 296613928 | Concerning Viruses:
What is "latent period"? | The interval between exposure to an infectious organism or a carcinogen and the appearance of symptoms or signs of disease | |
| 296613929 | Concerning Viruses:
What is "virulent"? | describes either disease severity or a pathogen's infectivity | |
| 296613930 | Concerning Viruses:
What is "temperate"? | A virus which, upon infection of a host, does not necessarily cause lysis (the breaking down of a cell) but whose genome may replicate in synchrony with that of the host. | |
| 296613931 | Concerning Viruses:
What is "dormant"? | its a virus that is in a resting state where it is not replicating and there are no symptoms | |
| 296613932 | Concerning Viruses:
What is "provirus"? | a virus genome that is integrated into the DNA of a host cell | |
| 296613933 | Concerning Viruses:
What is "reverse transcription"? | Just the opposite of transcription. (making more DNA from RNA) | |
| 296613934 | Concerning Viruses:
What is "retrovirus"? | A retrovirus is an RNA virus that is duplicated in a host cell using the reverse transcriptase enzyme to produce DNA from its RNA genome. The DNA is then incorporated into the host's genome by an integrase enzyme. The virus thereafter replicates as part of the host cell's DNA | |
| 296613935 | Is a virus alive? And what are it's components? | Viruses straddle the definition of life. They lie somewhere between supra molecular complexes and very simple biological entities. Viruses contain some of the structures and exhibit some of the activities that are common to organic life, but they are missing many of the others. In general, viruses are entirely composed of a single strand of genetic information encased within a protein capsule. Viruses lack most of the internal structure and machinery which characterize 'life', including the biosynthetic machinery that is necessary for reproduction. In order for a virus to replicate it must infect a suitable host cell | |
| 296613936 | lytic vs lysogenic cycle | The lytic cycle is typically considered the main method of viral replication, since it results in the destruction of the infected cell.[citation needed] A key difference between the lytic and lysogenic phage cycles is that in the lytic phage, the viral DNA exists as a separate molecule within the bacterial cell, and replicates separately from the host bacterial DNA. The location of viral DNA in the lysogenic phage cycle is within the host DNA, therefore in both cases the virus/phage replicates using the host DNA machinery, but in the lytic phage cycle, the phage is a free floating separate molecule to the host DNA. | |
| 296613937 | A man is found to be HIV positive. IS this an example of a virus in a lytic or lysogenic cycle? | Lysogenic | |
| 296613938 | What is the basic structure of a bacteria? | Capusle -This layer of polysaccharide (sometimes proteins) protects the bacterial cell and is often associated with pathogenic bacteria because it serves as a barrier against phagocytosis by white blood cells.
peptidoglycan cell wall - the cell wall maintains the overall shape of a bacterial cell
cellular membrane
no comples membrain-bound organells
single circular DNA chromosome
Tiny circular DNA molecules called plasmids | |
| 296613939 | What are the different bacterial shapes? | Bacilli - any rod-shaped
Cocci - spherical shape
Spirilla - a cell body that twists like a spiral | |
| 296613940 | Bacteria reproduction | Binary fission:
This type of division takes place without the formation of spindles. The single DNA molecule first replicates, then attaches each copy to a different part of the cell membrane. When the cell begins to pull apart, the replicate and original chromosomes are separated. The consequence of this asexual method of reproduction is that all the cells are genetically equal | |
| 296613941 | How do bacteria increase their genetic variability? | CONJUGATION:: transfer of genetic material between bacterial cells by direct cell-to-cell contact or by a bridge-like connection between two cells. One bacteria must have an F plasmid (F+); the F plasmid is a plasmid containing the gene for a sex pilus. The recipient can be (F-).
TRANSFORMATION: Pick up DNA from environment
TRANSDUCTION: viruses accedentally incorporates host genetic material into their nucleic acids | |
| 296613942 | Gram Positive | Stain purple
Very thick cell wall
Form endospores - dormant, tough, and temporarily non-reproductive structure which is like a seed
Single cell membrane | |
| 296613943 | Gram Negative | Stain pink
Relatively thin cell wall
Do NOT form endospores
Contain two (2) cell membranes: one inside the cell wall and one outside the cell wall | |
| 296613944 | Prokaryotes vs Eukaryotes Ribosomes | ribosomes in prokaryotes are a little larger | |
| 296613945 | Chemotroph | organisms that obtain energy by the oxidation of electron donors in their environments
can be either autotrophic or heterotrophic | |
| 296613946 | Phototroph | organisms that carry out photosynthesis to acquire energy
Most phototrophs are autotrophs, also known as photoautotrophs, and can fix carbon | |
| 296613947 | Autotroph | an organism that produces complex organic compounds (such as carbohydrates, fats, and proteins) from simple inorganic molecules using energy from light (by photosynthesis) or inorganic chemical reactions (chemosynthesis). They are the producers in a food chain, such as plants on land or algae in water | |
| 296613948 | Heterotroph | an organism that cannot fix carbon and uses organic carbon for growth | |
| 296613949 | A prime example of chemoautorophy are... | The nitrogen-fixing bacteria found in soil. | |
| 296613950 | How are fungi classified according to the chemotroph/photoroph and Autotroph/Heterotroph system? | Chemoheterotroph | |
| 296613951 | Are Fungi saprophytic? | Saprophytic - any organism that lives on dead organic matter
Yes | |
| 296613952 | What are fungi cell walls made of? | Chitin (same thing exoskeletons are made of) | |
| 296613953 | What is the name of a fungies growth phase? and is it haploid or diploid? | Hyphae
Haploid
Fungi spend the majority of their life in this phase | |
| 296613954 | Do fungi reproduce sexually or asexually? | both
Sexual Reproduction = when life is hard (little food, bad environment)
Asexual Reproduction = when life is good | |
| 301395931 | Which of the following is an accurate list of various components found in a DNA strand?
A. Nitrogenous bases, phosphates, phosphodiester linkages, hydrogen bonds and sulfones
B. Amines, nitrogenous bases, 2' hydroxyl groups and hydrogen bonds
C. Nitrogenous bases, phosphodiester linkages, amines and hydrogen bonds
D. Phosphodiester linkages, disulfide bonds, sugar backbone, and 2' hydrogens | C ; DNA contains everything listed in answer choice A except sulfones. B is true except for "2' hydroxyl
groups." These are found in RNA, but not in DNA. D is false because of the phrase "disulfide bonds," which
occur in folded proteins, not DNA molecules. C is thus the best answer. You may not recognize that amines
are included in DNA, although you should have accurately eliminated the other three answers and perhaps
inferred that "nitrogenous bases" would include amines. This would be a valid assumption because all DNA
bases do contain amine functional groups. | |
| 301395932 | A biology student denatures a sample of DNA, uses various enzymes to cut the DNA into individual nucleotides and evaluates the resulting sample using gas chromotography. Which of the following statements best describes the resulting chromatograph?
A. It contains four distinct signals, all of equal intensity
B. It contains four distinct signals, divided into two pairs of signals with equal intesities
C. It contains four distinct signals each with a different intensity
D. It contains 4², or 16 unique signals, one for each possible base pair combination | B ; It might be helpful here to remember the basics of gas chromatography, but not necessary. You should
ask yourself what will result after DNA is cut into individual nucleotides? There will be varying amounts of
nucleotides containing the four different nitrogenous bases (A,C,T & G). Gas chromatography separates
materials according to their boiling point and will usually produce a unique peak for each unique compound
or molecule. The amplitude, or intensity, of each peak will be a function of the number of those molecules
present. There will be four distinct peaks, but they will be divided into two pairs of peaks both with identical
amplitudes. Why? Because A pairs with T and C pairs with G; thus there will always be the same amounts of
both A&T and C&G. | |
| 301395933 | The DNA strand shown below is from the is from the coding strand of a section of human DNA. Which of the following gives the matching pre-mRNA sequence?
5' ATTCG 3'
A. 5' UAAGC 3'
B. 3' UAAGC 5'
C. 3' GCUUA 5'
D. 3' AUUCG 5' | C ; To answer this correctly, you must differentiate "coding strand" from "template strand." The template
strand is the one copied and the coding strand is the other strand, the complement to the template strand,
which is NOT copied. As a result (visualize this in your mind) the new DNA strand OR the new pre-mRNA
strand will be an exact copy of the coding strand (EXCEPT, in the case of pre-mRNA, T will be replaced with U).
The next skill you need is to keep careful track of the 3' and 5' ends. Normally, we need the strands to run in
opposite directions, so if the template strand was listed 5' to 3' the new strand would consist of the matching
base pairs running 3' to 5'. However, note that here you are NOT given the template strand, but the coding
strand. Thus, the coding strand and the new pre-mRNA strand will both run the same direction and will be
identical except for replacing T with U. C is the only answer satisfying all of these requirements. | |
| 301395934 | A biologist is studying a newly discovered virus. She performs an assay on a sample of several thousand virions and fins three major biological components, two of which were phospholipids and rubonucleic acids. Which of the following is likely the identity of the third component?
A. enzymes
B. carbohydrates
C. hormones
D. ribosomes | A ; Recall that viruses can contain either RNA or DNA as their genetic material, however, they will not contain
both. If they contain RNA, they will ALWAYS contain a specialized enzyme, reverse transcriptase. As is often
the case with the MCAT, you are expected to pick up on this clue. Hormones would not be produced by a
virus, nor found in a virion. A ribosome, would not be found in a virus either, they do not contain organelles.
Even if you thought they might, ribosomes are made of RNA, one of the components already mentioned.
Carbohydrates may be found on the cell surface of a virus, but would be a minor contributor compared to an
enzyme. | |
| 301395935 | All of teh folowing are true about bacteria EXCEPT:
I. Gram positive bacteria form endospores and have two cell membranes
II. Gram negative bacteria stain pink and have thinner cell walls than do gram positive.
III Gram positive bacteria stain purple and have peptidoglican cell walls.
IV. All bacteria contain organelles.
A. I only
B. II only
C. III IV
D. I and IV | A ; Answer choice A is correct. Statement I is false because gram positive bacteria only have one cell
membrane (it is gram negative that have two cell membranes). All of the remaining statements are true.
You may be tempted to say Statement IV is false because bacteria are prokaryotes; however, recall that
prokaryotes do not have "complex, membrane-bound" organelles, but do have simple ones such as ribosomes. | |
| 301395936 | The Lac Operon is an often studied bacterial gene that regulates the production of lactase, an enzyme that degrades lactose. Which of the following is true regarding the Lac Operon?
A. If lactose is present, the operon will be transcribed and translated.
B. If glucose is present, the operon will be transcribed and translated
C. If lactose is present but glucose is not, the operon will be transcribed, but not translated
D. If lactose is present but glucose is not, the operon will be3 transcribed and translated. | D ; This should be a gimme point. The only real thing you need to remember about the Lac Operon is that
lactose is a promoter, but glucose is an inhibitor. If lactose is present, its derivative, Allolactose binds to an
inhibitor near the beginning of the operon, causing the inhibitor to release. This would allow the transcription
of the gene EXCEPT for the fact that glucose acts as an inhibitor. If glucose is present at all, a second inhibitor
will prevent transcription. If glucose is absent, then this inhibitor is not in place and all that is needed for
transcription is the presence of lactose. C may be tempting, but there is no reason to believe that if the gene is
transcribed, it won't be also translated. | |
| 301395937 | Suppose a group of scientists is making an argument for the re-classification of a certain unique class of vertebrates into a new, previously non-existent subj-phylum. Which of the following findings would best support the need to make this re-classification?
A. The class is question shares several characteristics with other vertebrates
B. The class in question shares several characteristics with members of another non-vertebrate sub-phylum
C. Unique characteristics found in the class in question appear to represent and ancestral state
D. Unique characteristics found in the class in question appear to represent a degenerative state | D; Shared ancestral characteristics are indicative of evolutionary similarity
because they show a likelihood that the two species share a common evolutionary background. Degenerative
states are, by definition, different from ancestral states, indicating less similarity and less likelihood of common
evolutionary origin. In fact, degenerative states could even be thought of as the process of speciation—the
way in which new species diverge from their common ancestral heritage to form new species. | |
| 301395938 | The inability to curl one's tongue is a recessive trait. In a given population of 1,000 individuals randomly mating with one another, 90 cannot curl their tongue. How many members of this population have the recessive allele but can still curl their tongue? | A ; This is a Hardy-Weinberg Equilibrium question. Use the formulas p2 + 2pq + q2 = 1 and p + q = 1. Divide
90/1000 to get 0.09, the fraction of people who cannot curl their tongue. This represents q2. This is the step
where most students mess up, deciding what the numbers represent. The allele frequencies are the individual
letters, p and q. The prevalence among individuals comes from the squared letters. So, to get the allele
frequency, we must take the square root of 0.09, which is 0.3. Now we know q and can subtract from 1 to
get p, which is 0.7. 2pq always gives the frequency of carriers, which is 2(.3)(.7) = .42, or 42%. Forty-two
percent of 1,000 is answer A, 420. | |
| 301395939 | A man and a woman get married and have two children. A karyotype for each child is compared with each parent and it is found that each child has a unique, random combination of parental and maternal chromosomes. This provides direct support for which of Mendel's original observations regarding pea plants?
A. The Law of Independent Assortment
B. Test Cross for Heterozygosity
C. The Law of Segregation
D. The Law of Karyotype Variability | A ; Mendel's Law of Independent Assortment states that maternal and paternal homologues assort randomly at
the metaphase plate during meiosis, resulting in each child getting a random combination of chromosomes from
each parent. Answer D is nonsense and doesn't exist. Answer C is a true principle outlined by Mendel, but
it explains how alleles assort independent of one another (i.e., are not linked; which we have actually proven
does occur, but linkage is usually counteracted by frequent crossing over). Answer B is what Mendel did to
determine if something was a heterozygote or a homozygote, but is unrelated to this question. | |
| 301395940 | A small religious group migrated from upstate New York in the early 1800s and formed a colony in southern Pennsylvania. This colony has persisted thru multiple generations and a very high percentage of its members alive today suffer from rare heritable diseases. This case study is an excellent example of the deleterious effects of:
A. Genetic drift
B. Genetic Bottleneck
C. Natural Selection
D. K-selection | A ; Genetic drift is a change in the allele frequencies within a population due to something other than natural
selection. Genetic bottlenecks and the founder effect are both examples of events that result in rapid genetic
drift. The term bottleneck, however, usually refers to entire populations being reduced to a few individuals,
due to something like overhunting, or a natural disaster. In this case, the entire population did not decrease.
Rather, a small set of individuals of random genetic make up separated themselves from the rest of the
population. This is most precisely called the founder effect, but that is not offered as an answer choice.
Because this is not a genetic bottleneck, but is an example of genetic drift, A is the best answer. | |
| 301395941 | Bacteria do not undergo mitosis. The analogous process for cell division, binary fission, differs from mitosis in all of the following ways, EXCEPT:
A. In binary fission each daughter cell does not receive a full copy of the parental chromosome
B. Binary fission does not utilize a spindle apparatus
C. Binary fission occurs in prokaryotes, while mitosis occurs only in eukaryotes
D. Binary fission allows for exponential growth while mitosis dies not. | A; This is a good question to review binary fission vs. mitosis. Binary fission happens only in prokaryotes and
mitosis only in eukaryotes, making C true and not the EXCEPT we're looking for. Binary fission does not use a
spindle apparatus nor involve centrioles, nor alignment of chromosomes (bacteria have only one single circular
chromosome plus extrachromosomal DNA in the form of plasmids), making B true. Finally, binary fission is
part of the reason bacteria can reproduce exponentially, making D true. This leaves A as the EXCEPT answer.
Binary fission DOES produce two identical daughter cells. Each daughter cell gets a complete copy of the one
circular chromosome. However, there is no system for equal distribution of plasmids—meaning some genetic
variability will exist between generations. | |
| 301395942 | A given bacteria contains a gene that confers antibiotic resistance. In subsequent generations most, but not all, bacteria have this same trait. Ignoring the possibility of mutation, which of the following facts could explain this observation?
A. Bacteria undergo binary fission, which does not result in two identical daughter cells
B. The gene was located on a plasmid that was not equally distributed to the daughter cells
C. The gene was located on part of the chromosome that was not replicated
D. The gene was located on a telomere that was lost due to frequent replication | B;
Answer B says that the gene could be on a plasmid. This is the correct answer. Plasmids are small circular extrachromosomal pieces of DNA. Because binary fission is not as complex as mitosis, these free floating DNA bits do not always get equally distributed. The chromosome does because it is attached to the membrane and then split by it
during division. | |
| 301395943 | The origin of replication on a double-stranded DNA molecule is the location where the helix begins to unwind prior to replication. Eukaryotes usually have multiple origins, each consisting of a long sequence of repeating nucleotides. OF the four nucleotides, which is most likely to be found at the origin of replication? | Most origins of replication are heavy with AT pairs because AT is bound by two hydrogen bonds and CG pairs
are bound by three hydrogen bonds. It makes sense that the cell would conserve energy by making the origins
easier to open up. | |
| 301395944 | Small DNA strands are sometimes used as a delivery method for drugs or enzymes targeted for the nucleus. For such a DNA probe to be effective, it should be:
A. identical to its target sequence
B. complementary to its target sequence
C. identical to its target sequence, but with uracil substituted for thymine
D. complementary to the pre-mRNA strand that binds its target sequence | B; This is a frequent MCAT question. For two DNA strands to anneal to one another they must be
complementary, not identical. This makes B the only possible answer. Answer C confuses this with
transcription of mRNA. Answer D is logical, but would actually be the exact same sequence as answer A. | |
